الفهرس 
IntroductionOnly 14 pages are availabe for public view
 |  | from | 103 |  |  |
| | | from | 103 | | |
Abstract
Summary
The detection of genetic polymorphism of different genes that affect on reproduction and their association with some reproductive disorders in Egyptian buffaloes (Bubalus bubalis) is a very important and modern technique to evaluate the genetic relation to some critical complains like smooth inactive ovaries and silent heat in addition to, estimate the hormonal level of some hormones like LH and FSH of those animals and their relation with such animals that affected with ovarian inactivity and silent heat problems.
This study was designed for:
Investigate the genetic polymorphism of some genes like Luteinizing Hormone Receptor (lhr), Follicle Stimulation Hormone Receptor (fshr) and Cytochrome Polymerase 19 (cyp19) and their relation with some infertility problems like (ovarian inactivity and silent heat) in Egyptian buffaloes in addition to, the level of some hormones (LH, FSH) in the serum of selected animals and their participation in occurring of these infertility problems.
The procedures of the study:
1. Animals and sample collection
The study was carried out within the period from June 2021 till July 2022. The present study was conducted on a total number of 90 Egyptian buffaloes (1st to 4th lactation season " ~ "3-8 years old) at Menoufia governorate, Egypt. These animals were raised in small holder farms at approximately the similar managemental conditions. According to ovarian status after gynecological examination, animals were divided into three groups (30 animals for each group), the 1st group was suffering from ovarian inactivity, the 2nd group was suffering from silent heat and the 3rd group was the control animals without any gynecological problems. Serum was separated from coagulated blood samples by centrifugation (3000xg, 15 minutes) and kept at -20°C until use for assaying of LH and FSH level in the serum.
2. Genomic DNA Extraction
Using Genomic DNA Mini Kit (Blood/Cultured Cell, Geneaid Biotech Ltd., Taiwan) Fresh Blood Protocol, which included four steps:
a. Sample preparation and Cell lysis
b. DNA Binding
c. Washing
d. DNA Elution
3. Preparation of Agarose Gel and DNA Visualization
Preparation of 3% agarose gel for easily detection of DNA and bands of the genes under UV illuminator through dissolving of 1.5 gm of agarose powder in 50 ml 1X TAE (Tris Acetate EDTA) buffer using microwave for dissolving agarose powder then adding ethidium bromide (EtBr) for further easily seeing DNA with UV illuminator.
4. DNA amplification and RFLP-PCR
DNA amplification and RFLP-PCR were applied for further genotyping the selected genes of the study of all samples.
4.1. DNA amplification and RFLP-PCR for genotyping of lhr gene
A 303 bp fragment of exon 11 of lhr gene was amplified using specific forward and reverse primers were 5’ CAA ACT GAC AGT CCC CCG CTT T 3’ and 5’ CCT CCG AGC ATG ACT GGA ATG GC 3’ respectively.
The PCR product was checked on 3% agarose gel electrophoresis in 1x TAE buffer after staining with EtBr and visualized using E-Gel Imager. The restriction digestion was carried out at 37 °C for 15 minutes in a total volume of 15μl containing 10 μl of PCR product, 1.5 μl of 10X RE (rCutSmart) buffer, 0.5 µl HhaI enzyme (10 Units) and 3 µl DW. Digested samples (10 μl) were separated on 3% agarose gel containing EtBr at 2 V/cm for 1 h to determine the genotypes.
The result was revealed that the all PCR products (303 bp) of lhr / HhaI were undigested and found to be monomorphic in nature in all animals of the 1st and 3rd groups (ovarian inactivity and control group) and revealed the existence of an uncut banding pattern (TT genotype) at position 303 bp but the animals in the 2nd group (silent heat), the 303 bp PCR product remained undigested by HhaI restriction enzyme except, the homozygous genotype CC 155, 148 bp (overlapped bands) was detected only in one animal.
4.2. DNA amplification and RFLP-PCR for genotyping of fshr gene
The Exon 10 of fshr locus (with size 230bp) was amplified by PCR using specific forward and reverse primers which described as following:
Forward 5’ ATCACGCTGGAAAGATGGCATACC 3’
Reverse 5’ GACATTGAGCACAAGGAGGGAC 3’.
The PCR product was checked on 3% agarose gel electrophoresis in 1x TAE buffer after staining with EtBr and visualized using E-Gel Imager. For genotyping, PCR product was digested with Hin1II (NlaIII). Gene fragments were subjected to digestion by restriction enzymes in a total volume of 15 μl (10 μl reaction solution, 1.5 μl enzyme buffers, 0.5 μl enzymes and 3 μl water) and placed in the thermocycler at 37°C for 15 min. After digestion, the samples were quantified to visualize the amplified fragments by E-Gel Imager as mentioned in PCR with 3% agarose concentration.
The result was revealed that the PCR-RFLP which was used to identify the polymorphic changes were indicated that all animals showed polymorphic pattern at 30, 200 bp with GA genotype except, one animal from silent heat group showed monomorphic pattern at 230 bp which genotyped as AA.
4.3. DNA amplification and RFLP-PCR for genotyping of cyp19 gene
A DNA fragment which is a part of cyp19-distal promoter P1.1 was amplified using following primers: Forward, 5’ CAAGGGCCTCATATGGTTCA 3’
Reverse, 5’ CCAGATCAGAACCACCTTTGT 3’
PCR were performed in a 12.5 μl of reaction volume, which included (6.25 µl PCR master mix, 1 µl forward primer, 1 µl reverse primer, 2.25 µl DW and 2 µl DNA sample). The PCR products were screened by electrophoresis on a 3% agarose gel in a 1X of TAE buffer which stained with EtBr and visualized with E-Gel Imager.
For genotyping, PCR product was digested with PvuII restriction enzyme. Gene fragments were subjected to digestion by restriction enzymes in a total volume of 15 μl (10 μl reaction solution, 1.5 μl enzyme buffers, 0.5 μl enzymes and 3 μl DW) and placed in the thermocycler at 37°C for 15 min. After digestion, the samples were quantified to visualize the amplified fragments by E-Gel Imager as mentioned in PCR with 3% agarose concentration.
The result was revealed that the PCR- RFLP pattern showed that all the animals of first group (ovarian inactivity) and animals of third group (control group) depicted the GG genotype by 187 and 232 bp fragments. The second group (silent heat animals) showed only two animals with undigested PCR product a 419 bp with AA genotype and PCR- RFLP design for other animals revealed that A allele was absent in both the homozygous and heterozygous genotypes and represented the GG genotype as 187 and 232 bp fragments.
5. Detection of the LH and FSH concentration in the serum
For hormonal assay for both LH and FSH in the serum of all selected animal of this study, highly specific ELISA Kits (Fine Test®, Fine Biotech Co., Ltd., Wuhan, China) were used and according to manufacture instructions the level of LH and FSH in the serum were measured through principal steps which including preparation of washing buffer, preparation of the standard, preparation of biotin labeled antibody working solution and preparation of HRP-Streptavidin Conjugate (SABC) working solution. After complete all steps for all samples the Optical Density (OD) was measured by ELISA reader device then the target concentration of the samples can be interpolated from the standard curve.
The result was revealed that the concentration of LH in the serum in 1st group, 2nd group and 3rd group were recorded as (1.98 ± 0.088, 2.17 ± 0.057 and 2.2 ± 0.068) mIU/ml, respectively. The concentration of serum LH was showed a significant increase in the 2nd and 3rd group than the 1st group. The average concentration of FSH in 1st group, 2nd group and 3rd group were recorded as (110.5 ± 6.03, 128.7 ± 8.69 and 143.5 ± 17.56) mIU/ml, respectively. The results were showed the higher FSH level of control group than silent heat and ovarian inactivity groups with non-significant difference between the three groups.
6. Gene polymorphism in relation to hormonal expression
6. a. The genotypic frequencies of lhr gene were CC genotype (1.1%) for only one of the selected samples and TT genotype (98.9%) for the other 89 samples. The concentration of LH and FSH in the serum of the samples with CC genotype showed no significant difference to the concentration of the LH and FSH in the serum of the samples with TT genotype..
6. b. The genotypic frequencies of fshr gene were AA genotype (1.1%) for only one of the selected samples and GA genotype (98.9%) for the other 89 samples. The concentration of LH and FSH in the serum of the samples with AA genotype has showed no significant difference to the concentration of the LH and FSH in the serum of the samples with GA genotype.
6. c. The genotypic frequencies of cp19 gene were AA genotype (2.2%) for only two of the selected samples and GG genotype (97.8%) for the other 88 samples. The concentration of LH and FSH in the serum of the samples with AA genotype has showed no significant difference to the concentration of the LH and FSH in the serum of the samples with GG genotype.